Biomolecules, 10 (5), 687
Healthy habits include following routines like regular exercise, a balanced diet rich in whole foods, and getting adequate amounts of restorative sleep
The tissue is prehybridized in prehybridization buffer (50% formamide, 25% 2 SSC, 0.3 mg/ml yeast RNA, 0.1 mg/ml heparin, 1 Denhardts solution, 0.1% Tween-20, 5 mM EDTA) for 2 h at room temperature, before hybridizing with digoxigenin-labeled antisense cRNA probes for CAMKII (873 bp amplified by primers AGTCTCCAAGCCAACCCC and ATAGAGCGCACACCAGGC from NM_009792.1) and GAD2 (869 bp amplified by primers TCTTTTCTCCTGGTGGCG and AAATCTTGTCCGAGGCGTTCG from NM_008078.1) for 20 h at 65 C in the same buffer
Experimental Chemical s and materials All the chemicals used were of analytical grade
Johnson FK, Johnson RA, Peyton KJ, Durante W